1、English for Biology Students 1001班 【32】Rachel(涂瑞倩) English for Biology Students, at first glance, Its a pretty daunting subject. However, under the leadership of the teacher Zhang ,we enjoyed it ! Now, go back and have a look at the way we have go throught, but find with love. To beginning with the
2、fear and then relieved,but end with love. English for Biology Students brought me a lot of fun, sentiment and help. Teacher Zhang not only give us the professional English knowledge, whats more, he also gave us a lot of knowledge those outside of textbooks. He is an excellent professional teacher,He
3、 made me understand though excellent professional level is important,comprehensive ability and broaden our knowledge is indispensable.His many rich in philosophy, still so vivid in my mind! “Summary or the abbreviation choose one from the two to do as last job about the Biological professional Engli
4、sh. Originally I thought: abbreviation. Read an English literature, and then a little understanding, abbreviations would not be a problem. However, I still want to challenge myself. Not seeking compared with others, but to surpass myself! So decisively I choose a larger review of the risk-summary .
5、Fortunately, sophomore year, I served as the Minister of Science and Technology of Life Science, I have archived papers of all research projects. Of course, these papers of aresearch projects I wouldnt rumor. I only reference them to practice my English skills. The site and the mechanism of oxidatio
6、n of Arginine kinaseAbstract Arginine kinase (arginine kinase, AK) (EC2.7.3.3) is a phosphodiesterase guanidines kinase, composed of 403 amino acids, which contains five cysteines (Cys23, Cys127, Cys139, Cys201, Cys271), the experiment we found that the oxidation state band and restore the state wit
7、h the phenomenon of electrophoresis AK, and through a series of biotechnology means, respectively, of these five sites Cys mutated to serine (Ser), to identify oxidation sites and to study the oxidation mechanism, and by UV fluorescence, respectively, to explore the structure after the mutation of t
8、he the AK various sites related to activity.Key words: Arginine kinase, rite-directed mutation, oxidation sites, SDS-PAGEIntroduction1.Arginine kinase1 (Arginine kinase AK) (EC2.7.3.3) is a kinase of a phosphorylated original guanidino compound exists widely in invertebrates, and is an important kin
9、ase that has a direct relationship with intracellular energy operation, muscle contraction, ATP-regenerating . Its Function is how to Catalytic reversible reactions by the following step: ATP phosphate group is transferred to the arginine, thereby forming a high energy bond energy storage molecules
10、 arginine phosphate. The reaction equation is as follows:Mg2 + ATP + Arg Mg2 + ADP + Arginine phosphate early in 1998, Mr Zhou with some people have used the crystal structure of the transition state AK from horseshoe crabs by horseshoe to crab the Limulus polyphemus single subunit AK dissociation
11、combined transition state analogs. The results showed that the AK was made up by a small -helix of the N-terminal domain and a large C-terminal structure (112, -357 residues). The C-terminal domain is Similar to the C-terminal domain of glutamate synthase, the the Bagu antiparallel -sheet is around
12、by seven -helical package 2. Seen from this structure, the transition state analog is not incorporated in the middle of the two domains, but combined in the C-terminal s Interior region, which means that the AK is the active site in the C terminal. In addition, the C-terminal domain can be divided i
13、nto two small structure, while a transition state analogs is incorporated at the junction of the two domains 3. According to Mr. Zou Chenglus point of view that the active site of the enzyme is in a relatively flexible portion and is the parts of the structure ,and this Position is more susceptible
14、from the impact of adverse external factors than other parts , the result is that the enzyme activity loss faster and easier than the enzyme of the whole structure .2 .The oxidation of protein Different types of oxidative damage in protein is an important facter of the cause of many serious diseases
15、 (such as: cancer, diabetes, neurodegenerative diseases) The chaperone protein oxidative damage of ER , will lead to the misfolding and aggregation diseases in protein, such as: AD, Parkinsons disease (Parkinsons disease, PD), amyotrophic lateral sclerosis (amyotrophic of lateral sclerosis, ALS), an
16、d Hang extension Raton chorea (Huntingtonsdisease, HD), and senescence-related diseases, an important common feature of them is the abnormal protein in the brain within the accumulation. In the experiment of electrophoretic detection with AK we found the oxidation state band and reduced state band .
17、Revelated by the research methods of creatine kinase (CK), we make 5 sites Cys of AK mutated to serine (Ser), then use ofaffinity chromatography, UV, fluorescence, such as a range of biotechnology tools explore this structure and related activity after five Cys point mutation, respectively, looking
18、for the oxidation of arginine kinase locus and try to reveal the mechanism of the oxidation, Cys was oxidize to form the S-S disulfide bonds, hydrophobic structure exposed, so that the red-shifted fluorescence sweep conformation, so we make mutations in all five Cys sites, hoping to pave the way for
19、 the protein folding mechanism.1 Materials and methods1.1 Materials1.1.1 MaterialsE. coli m 15 (containing the recombinant plasmids carrying the AK gene pQE60 vector)pET28b plasmid, E. coli DH5 (E.coli DH5)Expression strain Rosetta(provided by the real Save laboratory )1.1.2 Main equipmentYC-1 type
20、the chromatography experiments freezer (Beijing BrainLAB Kang the experimental apparatus Division)CXG-1-type computer thermostat chromatography cabinet (Shanghai the Huxi Analysis Instrument Factory Co., Ltd.)HD-3 UV detector (Shanghai Huxi Analytical Instrument Factory Co., Ltd.)TGL-16LA the GL-2M
21、type freezer centrifuge (Hunan Star Scientific Instrument Co., Ltd.)GL-2M type refrigerated centrifuge (Hunan the Star Scientific Instrument Co., Ltd.)Snow Mountain ice machine (Changyangdian Scientific Instruments Corporation)Ultrapure water machine AYJ1-0501-U (the Yee Young Enterprise Development
22、 Co., Ltd.)DH-2120 low temperature thermostat bath(the Haijia Peng Technology Co., Ltd.)Electrophoresis instrument DYY-5 (Beijing sixty-one Instrument Factory)BS-1E shaking incubator (Jintan City, Jiangsu Province, Yitong Electronic Instrument Factory)SW-CJ-1FD Single Sided Clean Bench (Suzhou Purif
23、ication Equipment Co., Ltd.)3FG-01B electric thermostat Blast OvenAutoclave YXQ-LS-50S (of Haibo Motion Limited)PCR machine (Biometra, Germany)PH meter (ORION3STAR, Thermo orion)Electronic balance (TE412-L, CP64, Germany Satorins Company)UV spectrophotometer (U-4300, Sweden / GE)Fluorescence spectro
24、photometer (F-4500, Hitachi)Protein purification AKTA-purifier analyzer (Sweden / GE)Ultrasonic cell pulverizer (XO-650, Nanjing first European Biological Technology Co., Ltd.) 1.1.3 Reagents and solutionKOD-Plus-Mutagenesis Kit Toyobo Biology (Shanghai)Technology Co, Ltd; synthesis and DNA sequenci
25、ng of PCR primers to complete by the Shanghai Biological Engineering Co, Ltd.Reagents:Iso propyl thio-D-galactoside (IPTG)Sodium dodecyl sulfate (SDS)Mercaptoethanol (Bibtehnology Grad)His-nickel affinity chromatography resin (GE Healthcare)All other reagents were of analytical gradeMolecular biolog
26、y in a variety of commonly used buffered solution is formulated see Molecular Cloning (Third Edition)Other major solution formula:Weighing 2.4228 g Tris-base and 29.25 g NaCl, add distilled water volume to 1L 1L 5 * Binding buffer buffer: HCL adjusted to pH 8.0 with diluted 1 * binding buffer.Measur
27、ing enzyme activity Substrate: 57mm Arg at 2ml, 66mM Mg (AC) 2.0 ml, thymol blue indicator 2.0 ml ATP 0.0532g, distilled water 14 ml Add NaOH to pH8.2.Cystine .1.2 Methods1.2.1 FKBP12 gene amplificationAK C23S UP CCAAGTCTCTCCTTAAGAAGTATCTTAC AK C23S DOWN AGTCGGTGGCGGCTTCAAGTTTCTTGAAA AK C127S UP CCG
28、GTCGCTCAATGCAAGGTTACCCCTT AK C127S DOWN AGCGGACTCGGGTGGAGATAACGAACTT AK C139S UP CTCACTGAGTCTCAGTACAAAGAGATGGA AK C139S DOWN GGAGGGGTTGAAGGGGTAACCCTGC AK C201S UP CCCGCTACTGGCCCGCCGGACGTGGAAT AK C201S DOWN AAGCGTTGGCTGCTTGCAGGAAGCGGT AK C271S UP AGTCCCACCAACCTTGGCACCACTGTGC AK RC271S DOWN GAAAGTGAGG
29、AAGCCCAGGCGGTCGTG 1.2.2 AK-wt and AK-mutant protein induced expression and purification1.2.2.1 activation of recombinant strain Recombinant strain the Rosetta / AK-Mutant and Rosetta / AK-wt were inoculated into 6 ml of LB medium (a medium inclusive final concentration of 50g / ml Kana) and cultured
30、 for 12 hours in 37 C overnight, shaking speed of 200rpm .1.2.2.2 expanding culture and expression Activation of the strains the Rosetta / AK-the mutant and Rosetta / AK-wt vaccination in Kana containing 300 mL LB culture medium conical flask (medium contain a final concentration of 50 g / mL), 37 C
31、 shaking culture 2 to 3 hours to A600 of about 0.6 to 0.8, the Rosetta / AK-Mutant added IPTG to a final concentration of 0.2mM placed 20 shaker, 180rpm, inducible expression, to continue the culture for 12 hours. The Rosetta / AK-wt added IPTG to a final concentration of 0.5mM at 37 shaker 180rpm i
32、nduced expression, the culture was continued for 5 hours.1.2.2.3 protein crude extract(1) The cell culture was centrifuged, 6000 rpm, centrifuged for 10 min;(2) The supernatant was discarded, the centrifugal wall of the bacterial cells was added a certain amount (about 25 mL) wash buffer;(3) again b
33、y centrifugation, 6000 rpm, centrifugation for 10 min;(4) The supernatant was discarded, the buffer solution in a certain amount (about 25 mL) is added to the bacterial cells, resuspended bacterial cells;(5) diligent ratio to 50% of the sonicator breaking the bacterial cell wall, a transparent solut
34、ion is appropriate;(6) was at 4 , 12000 rpm, centrifugation 15 min, the supernatant;(7) by SDS-PAGE electrophoresis 6,7 detect inducible expression results;1.2.2.4. AK-mutant and AK-wt protein purification(1) Rosetta / AK-wt and Rosetta / AK-mutant, crude extracts were purified by affinity chromatog
35、raphy and Ni column 4: the sample with 10 mM imidazole and 250mM imidazole gradient elution;(2) electrophoresis detection, the target group will be collected, respectively, with 1 * binding buffer buffer solution (pH 7.5,5mM, -mercapto-ethanol)-containing dialysis;(3) PEG8000 concentrated to increas
36、e its concentration.1.2.3 Determination of protein concentration and enzyme activity 7(1) Protein concentration determination: Ultrospec 4300 pro UV spectrophotometer(Instrument Control Program), with a 1 cm quartz cuvette (200 L system) to the buffer as a control, were measured at 280 nm the protei
37、n absorbance A280 nm, records obtained read Number. The parallel determination triplicate. The target protein is obtained according to the Beer-Lambert law, using the formula A = cLQuality concentrations. is the extinction coefficient = 28260 M-1 cm-1 11, C is the protein concentration, L is the opt
38、ical path of the cuvette.(2) Determination of enzyme activity: Ultrospec 4300 pro UV spectrophotometer (Instrument Control Program), a 1 cm plastic cuvette (1000L system), first with a micropipettor take 990 l of substrate is placed in the cuvette , then a small-scale micro-pipetting 10L cuvettes pl
39、aced than the color cup on the wall is not in contact with the substrate, the thumb parafilm cover cuvette fluctuate up and down rapidly, the substrate and enzyme mix measurement and quickly placed in a spectrophotometer at 390 nm every 2 s recording time data, continuous detection 1min or until the
40、 termination of the reaction, to record the progress of the reaction curve, to measure the enzymatic substrate for the control group. 500 L measured live system control group and the experimental group reagent dosage as follows:Control group (1000L substrate)Experimental group 1 (990 L substrate +10
41、 LAK-wt)Experimental group 2 (990 L substrate +10 LAK-C23S)Experimental group 3 (990 L substrate +10 LAK-C127S)Experimental group 4 (990 L substrate +10 LAK-C139S)The Experiments group of 5 (990 L substrate +10 LAK-C201S)Experimental group (990 L substrate +10 LAK-C271S)1.2.4 Endogenous fluorescence
42、 spectroscopy Adjusting the concentration of the AK-WT and mutant (C23S, C127S, C139S, C201S, C271S) (protein concentration 51.15um / L), with the F-4500 fluorescence spectrophotometer endogenous fluorescence, room temperature setting excitation wavelength located set at 295 nm, a slit width of 5 nm
43、 / 5 nm, the scanning rate of 1200 nm / min between the fluorescence spectrum recorded from 300 nm to 400 nm.1.2.5 ANS fluorescence spectroscopy Weigh the ANS electronic balance dark (molecular weight 316.18) 0.008 g, 4ml1 * binding buffer shocks dissolved, take the preparation of a good ANS solutio
44、n and protein samples (AK-WT, C23S, C127S, C139S, C201S, C271S protein concentration each 500ul 51.15um / L), 1:1 mixture to react at room temperature under the dark conditions for 30min, so that a final concentration of ANS in the test sample is greater than the protein samples to a final concentra
45、tion of 50 times, taking 800ul test sample placed in fluorescence trace between the excitation wavelength set at 380 nm and a slit width of 5 nm / 5 nm, scan rate of 1200 nm / min records from 400 nm to 600 nm fluorescence cuvette.1.2.6 Protein oxidation sites inquiry Cystine processing: AK-wt, AK-C
46、23S, AK-C127S, AK-C139S, AK-C201S, AK-C271S concentration tone is consistent, its OD values are about 1.3, were taken 30ul placed in the EP tube to EP were added Cystine, to give a final concentration of 0.5mmol, placed overnight in a refrigerator, and detected with a NON-reduce SDS-PAGE.2 Results a
47、nd Analysis2.1 AK-wt and AK-mutant induced expression and purificationAK-wt and AK-mutant, the SDS-PAGE analysis of crude extracts:Figure 1 AK-mutant expression of SDS-PAGE1. Uninduced Rossetta / AK-mutant cell lysate supernatant;2. IPTG induction Rossetta / AK-C23S cell lysate supernatant;3. IPTG i
48、nduction Rossetta / AK-C127S cell lysate supernatant;4. IPTG induction Rossetta / AK-C139S cell lysate supernatant;5. IPTG induction Rossetta / AK-C201S cell lysate supernatant;6. IPTG induction Rossetta / AK-C271S cell lysate supernatant;Figure 2 AK-wt expression and purification of the SDS-PAGE2.2 Determination of activity Figure 3 AK-wt and AK-mutant enzyme activity analysis chartAK-C271S mutant lost activity and AK-wt slightly lower than activity, C127S and C23S mutation analysis can be drawn from the Figure.2.3 Endogenous fl