生物专业英语综述作业.doc

《English for Biology Students》 1001班 【32】Rachel（涂瑞倩）
《 English for Biology Students》, at first glance, It's a pretty daunting subject. However, under the leadership of the teacher Zhang ,we enjoyed it ! Now, go back and have a look at the way we have go throught, but find with love.
To beginning with the "fear" and then "relieved",but end with "love". 《English for Biology Students》 brought me a lot of fun, sentiment and help. Teacher Zhang not only give us the professional English knowledge, what's more, he also gave us a lot of knowledge those outside of textbooks. He is an excellent professional teacher,He made me understand though excellent professional level is important，comprehensive ability and broaden our knowledge is indispensable.His many rich in philosophy, still so vivid in my mind!
“Summary or the abbreviation" choose one from the two to do as last job about the Biological professional English. Originally I thought: abbreviation. Read an English literature, and then a little understanding, abbreviations would not be a problem. However, I still want to challenge myself. Not seeking compared with others, but to surpass myself! So decisively I choose a larger review of the "risk"--summary . Fortunately, sophomore year, I served as the Minister of Science and Technology of Life Science, I have archived papers of all research projects. Of course, these papers of aresearch projects I wouldn't rumor. I only reference them to practice my English skills.
The site and the mechanism of oxidation of Arginine kinase
Abstract
Arginine kinase (arginine kinase, AK) (EC2.7.3.3) is a phosphodiesterase guanidines kinase, composed of 403 amino acids, which contains five cysteines (Cys23, Cys127, Cys139, Cys201, Cys271), the experiment we found that the oxidation state band and restore the state with the phenomenon of electrophoresis AK, and through a series of biotechnology means, respectively, of these five sites Cys mutated to serine (Ser), to identify oxidation sites and to study the oxidation mechanism, and by UV fluorescence, respectively, to explore the structure after the mutation of the the AK various sites related to activity.
Key words: Arginine kinase, rite-directed mutation, oxidation sites, SDS-PAGE

Introduction
1.Arginine kinase[1] (Arginine kinase AK) (EC2.7.3.3) is a kinase of a phosphorylated original guanidino compound exists widely in invertebrates, and is an important kinase that has a direct relationship with intracellular energy operation, muscle contraction, ATP-regenerating . Its Function is how to Catalytic reversible reactions by the following step: ATP phosphate group is transferred to the arginine, thereby forming a high energy bond energy storage molecules - arginine phosphate.
The reaction equation is as follows:
Mg2 + ATP + Arg Mg2 + ADP + Arginine phosphate
early in 1998, Mr Zhou with some people have used the crystal structure of the transition state AK from horseshoe crabs by horseshoe to crab the Limulus polyphemus single subunit AK dissociation combined transition state analogs. The results showed that the AK was made up by a small α-helix of the N-terminal domain and a large C-terminal structure (112, -357 residues). The C-terminal domain is Similar to the C-terminal domain of glutamate synthase, the the Bagu antiparallel β-sheet is around by seven α-helical package [2]. Seen from this structure, the transition state analog is not incorporated in the middle of the two domains, but combined in the C-terminal 's Interior region, which means that the AK is the active site in the C terminal. In addition, the C-terminal domain can be divided into two small structure, while a transition state analogs is incorporated at the junction of the two domains [3]. According to Mr. Zou Chenglu's point of view that the active site of the enzyme is in a relatively flexible portion and is the parts of the structure ,and this Position is more susceptible from the impact of adverse external factors than other parts , the result is that the enzyme activity loss faster and easier than the enzyme of the whole structure .

2 .The oxidation of protein
Different types of oxidative damage in protein is an important facter of the cause of many serious diseases (such as: cancer, diabetes, neurodegenerative diseases) The chaperone protein oxidative damage of ER , will lead to the misfolding and aggregation diseases in protein, such as: AD, Parkinson's disease (Parkinson's disease, PD), amyotrophic lateral sclerosis (amyotrophic of lateral sclerosis, ALS), and Hang extension Raton chorea (Huntington'sdisease, HD), and senescence-related diseases, an important common feature of them is the abnormal protein in the brain within the accumulation.
In the experiment of electrophoretic detection with AK we found the oxidation state band and reduced state band .Revelated by the research methods of creatine kinase (CK), we make 5 sites Cys of AK mutated to serine (Ser), then use ofaffinity chromatography, UV, fluorescence, such as a range of biotechnology tools explore this structure and related activity after five Cys point mutation, respectively, looking for the oxidation of arginine kinase locus and try to reveal the mechanism of the oxidation, Cys was oxidize to form the S-S disulfide bonds, hydrophobic structure exposed, so that the red-shifted fluorescence sweep conformation, so we make mutations in all five Cys sites, hoping to pave the way for the protein folding mechanism.
1 Materials and methods
1.1 Materials
1.1.1 Materials
E. coli m 15 (containing the recombinant plasmids carrying the AK gene pQE60 vector)
pET28b plasmid, E. coli DH5α (E.coli DH5α)
Expression strain Rosetta(provided by the real Save laboratory )
1.1.2 Main equipment
YC-1 type the chromatography experiments freezer (Beijing BrainLAB Kang the experimental apparatus Division)
CXG-1-type computer thermostat chromatography cabinet (Shanghai the Huxi Analysis Instrument Factory Co., Ltd.)
HD-3 UV detector (Shanghai Huxi Analytical Instrument Factory Co., Ltd.)
TGL-16LA the GL-2M type freezer centrifuge (Hunan Star Scientific Instrument Co., Ltd.)
GL-2M type refrigerated centrifuge (Hunan the Star Scientific Instrument Co., Ltd.)
Snow Mountain ice machine (Changyangdian Scientific Instruments Corporation)
Ultrapure water machine AYJ1-0501-U (the Yee Young Enterprise Development Co., Ltd.)
DH-2120 low temperature thermostat bath(the Haijia Peng Technology Co., Ltd.)
Electrophoresis instrument DYY-5 (Beijing sixty-one Instrument Factory)
BS-1E shaking incubator (Jintan City, Jiangsu Province, Yitong Electronic Instrument Factory)
SW-CJ-1FD Single Sided Clean Bench (Suzhou Purification Equipment Co., Ltd.)
3FG-01B electric thermostat Blast Oven
Autoclave YXQ-LS-50S (of Haibo Motion Limited)
PCR machine (Biometra, Germany)
PH meter (ORION3STAR, Thermo orion)
Electronic balance (TE412-L, CP64, Germany Satorins Company)
UV spectrophotometer (U-4300, Sweden / GE)
Fluorescence spectrophotometer (F-4500, Hitachi)
Protein purification AKTA-purifier analyzer (Sweden / GE)
Ultrasonic cell pulverizer (XO-650, Nanjing first European Biological Technology Co., Ltd.)
1.1.3 Reagents and solution
KOD-Plus-Mutagenesis Kit Toyobo Biology (Shanghai)Technology Co, Ltd; synthesis and DNA sequencing of PCR primers to complete by the Shanghai Biological Engineering Co, Ltd.
Reagents:Iso propyl thio-β-D-galactoside (IPTG)
Sodium dodecyl sulfate (SDS)

Mercaptoethanol (Bibtehnology Grad)
His-nickel affinity chromatography resin (GE Healthcare)
All other reagents were of analytical gradeMolecular biology in a variety of commonly used buffered solution is formulated see "Molecular Cloning (Third Edition)Other major solution formula:Weighing 2.4228 g Tris-base and 29.25 g NaCl, add distilled water volume to 1L 1L 5 * Binding buffer buffer: HCL adjusted to pH 8.0 with diluted 1 * binding buffer.Measuring enzyme activity Substrate: 57mm Arg at 2ml, 66mM Mg (AC) 2.0 ml, thymol blue indicator 2.0 ml ATP 0.0532g, distilled water 14 ml Add NaOH to pH8.2.Cystine .
1.2 Methods

1.2.1 FKBP12 gene amplification
AK C23S UP
CCAAGTCTCTCCTTAAGAAGTATCTTAC
AK C23S DOWN
AGTCGGTGGCGGCTTCAAGTTTCTTGAAA
AK C127S UP
CCGGTCGCTCAATGCAAGGTTACCCCTT
AK C127S DOWN
AGCGGACTCGGGTGGAGATAACGAACTT
AK C139S UP
CTCACTGAGTCTCAGTACAAAGAGATGGA
AK C139S DOWN
GGAGGGGTTGAAGGGGTAACCCTGC
AK C201S UP
CCCGCTACTGGCCCGCCGGACGTGGAAT
AK C201S DOWN
AAGCGTTGGCTGCTTGCAGGAAGCGGT
AK C271S UP
AGTCCCACCAACCTTGGCACCACTGTGC
AK RC271S DOWN
GAAAGTGAGGAAGCCCAGGCGGTCGTG
1.2.2 AK-wt and AK-mutant protein induced expression and purification
1.2.2.1 activation of recombinant strain
Recombinant strain the Rosetta / AK-Mutant and Rosetta / AK-wt were inoculated into 6 ml of LB medium (a medium inclusive final concentration of 50μg / ml Kana) and cultured for 12 hours in 37 ° C overnight, shaking speed of 200rpm .
1.2.2.2 expanding culture and expression
Activation of the strains the Rosetta / AK-the mutant and Rosetta / AK-wt vaccination in Kana containing 300 mL LB culture medium conical flask (medium contain a final concentration of 50 μg / mL), 37 ° C shaking culture 2 to 3 hours to A600 of about 0.6 to 0.8, the Rosetta / AK-Mutant added IPTG to a final concentration of 0.2mM placed 20 ℃ shaker, 180rpm, inducible expression, to continue the culture for 12 hours. The Rosetta / AK-wt added IPTG to a final concentration of 0.5mM at 37 ℃ shaker 180rpm induced expression, the culture was continued for 5 hours.
1.2.2.3 protein crude extract
(1) The cell culture was centrifuged, 6000 rpm, centrifuged for 10 min;
(2) The supernatant was discarded, the centrifugal wall of the bacterial cells was added a certain amount (about 25 mL) wash buffer;
(3) again by centrifugation, 6000 rpm, centrifugation for 10 min;
(4) The supernatant was discarded, the buffer solution in a certain amount (about 25 mL) is added to the bacterial cells, resuspended bacterial cells;
(5) diligent ratio to 50% of the sonicator breaking the bacterial cell wall, a transparent solution is appropriate;
(6) was at 4 ℃, 12000 rpm, centrifugation 15 min, the supernatant;
(7) by SDS-PAGE electrophoresis [6,7] detect inducible expression results;

1.2.2.4. AK-mutant and AK-wt protein purification
(1) Rosetta / AK-wt and Rosetta / AK-mutant, crude extracts were purified by affinity chromatography and Ni column [4]: the sample with 10 mM imidazole and 250mM imidazole gradient elution;
(2) electrophoresis detection, the target group will be collected, respectively, with 1 * binding buffer buffer solution (pH 7.5,5mM, β-mercapto-ethanol)-containing dialysis;
(3) PEG8000 concentrated to increase its concentration.
1.2.3 Determination of protein concentration and enzyme activity [7]
(1) Protein concentration determination: Ultrospec 4300 pro UV spectrophotometer(Instrument Control Program), with a 1 cm quartz cuvette (200 μL system) to the buffer as a control, were measured at 280 nm the protein absorbance A280 nm, records obtained read Number. The parallel determination triplicate. The target protein is obtained according to the Beer-Lambert law, using the formula A = εcLQuality concentrations. ε is the extinction coefficient ε = 28260 M-1 cm-1 [11], C is the protein concentration, L is the optical path of the cuvette.
(2) Determination of enzyme activity: Ultrospec 4300 pro UV spectrophotometer (Instrument Control Program), a 1 cm plastic cuvette (1000μL system), first with a micropipettor take 990 μl of substrate is placed in the cuvette , then a small-scale micro-pipetting 10μL cuvettes placed than the color cup on the wall is not in contact with the substrate, the thumb parafilm cover cuvette fluctuate up and down rapidly, the substrate and enzyme mix measurement and quickly placed in a spectrophotometer at 390 nm every 2 s recording time data, continuous detection 1min or until the termination of the reaction, to record the progress of the reaction curve, to measure the enzymatic substrate for the control group. 500 μL measured live system control group and the experimental group reagent dosage as follows:
Control group (1000μL substrate)
Experimental group 1 (990 μL substrate +10 μLAK-wt)
Experimental group 2 (990 μL substrate +10 μLAK-C23S)
Experimental group 3 (990 μL substrate +10 μLAK-C127S)
Experimental group 4 (990 μL substrate +10 μLAK-C139S)The Experiments group of 5 (990 μL substrate +10 μLAK-C201S)
Experimental group (990 μL substrate +10 μLAK-C271S)
1.2.4 Endogenous fluorescence spectroscopy
Adjusting the concentration of the AK-WT and mutant (C23S, C127S, C139S, C201S, C271S) (protein concentration 51.15um / L), with the F-4500 fluorescence spectrophotometer endogenous fluorescence, room temperature setting excitation wavelength located set at 295 nm, a slit width of 5 nm / 5 nm, the scanning rate of 1200 nm / min between the fluorescence spectrum recorded from 300 nm to 400 nm.
1.2.5 ANS fluorescence spectroscopy
Weigh the ANS electronic balance dark (molecular weight 316.18) 0.008 g, 4ml1 * binding buffer shocks dissolved, take the preparation of a good ANS solution and protein samples (AK-WT, C23S, C127S, C139S, C201S, C271S protein concentration each 500ul 51.15um / L), 1:1 mixture to react at room temperature under the dark conditions for 30min, so that a final concentration of ANS in the test sample is greater than the protein samples to a final concentration of 50 times, taking 800ul test sample placed in fluorescence trace between the excitation wavelength set at 380 nm and a slit width of 5 nm / 5 nm, scan rate of 1200 nm / min records from 400 nm to 600 nm fluorescence cuvette.

1.2.6 Protein oxidation sites inquiry
Cystine processing: AK-wt, AK-C23S, AK-C127S, AK-C139S, AK-C201S, AK-C271S concentration tone is consistent, its OD values ​​are about 1.3, were taken 30ul placed in the EP tube to EP were added Cystine, to give a final concentration of 0.5mmol, placed overnight in a refrigerator, and detected with a NON-reduce SDS-PAGE.
2 Results and Analysis
2.1 AK-wt and AK-mutant induced expression and purification
AK-wt and AK-mutant, the SDS-PAGE analysis of crude extracts:

Figure 1 AK-mutant expression of SDS-PAGE
1. Uninduced Rossetta / AK-mutant cell lysate supernatant;
2. IPTG induction Rossetta / AKC23S cell lysate supernatant;
3. IPTG induction Rossetta / AK-C127S cell lysate supernatant;
4. IPTG induction Rossetta / AK-C139S cell lysate supernatant;
5. IPTG induction Rossetta / AK-C201S cell lysate supernatant;
6. IPTG induction Rossetta / AK-C271S cell lysate supernatant;

Figure 2 AK-wt expression and purification of the SDS-PAGE
2.2 Determination of activity

Figure 3 AK-wt and AK-mutant enzyme activity analysis chart
AK-C271S mutant lost activity and AK-wt slightly lower than activity, C127S and C23S mutation analysis can be drawn from the Figure.
2.3 Endogenous fl