GJB2基因突变引起耳聋.pdf

Novel Mutations in the Connexin 26 Gene(GJB2)Responsible for Childhood Deafness in theJapanese PopulationTakayuki Kudo,1,2*Katsuhisa Ikeda,1Shigeo Kure,2Yoichi Matsubara,2Takeshi Oshima,1Ken-ichi Watanabe,1Tetsuaki Kawase,1Kuniaki Narisawa,2and Tomonori Takasaka11Department of Otorhinolaryngology,Head and Neck Surgery,Tohoku University School of Medicine,Sendai,Japan2Department of Medical Genetics,Tohoku University School of Medicine,Sendai,JapanMutations in the connexin 26 gene(GJB2),which encodes a gap-junction protein and isexpressed in the inner ear,have been shownto be responsible for a major part of nonsyn-dromic hereditary prelingual(early-child-hood)deafness in Caucasians.We have se-quenced the GJB2 gene in 39 Japanese pa-tients with prelingual deafness(group 1),39Japanese patients with postlingual progres-sive sensorineural hearing loss(group 2),and 63 Japanese individuals with normalhearing(group 3).Three novel mutationswere identified in group 1:a single nucleo-tide deletion(235delC),a 16-bp deletion(176-191 del(16),and a nonsense mutation(Y136X)in five unrelated patients.The235delC mutation was most frequently ob-served,accounting for seven alleles in 10mutant alleles.Screening of 203 unrelatednormal individuals for the three mutationsindicated that the carrier frequency of the235delC mutation was 2/203 in the Japanesepopulation.No mutation was found ingroup-2 patients.We also identified twonovel polymorphisms(E114G and I203T)aswell as two previously reported polymor-phisms(V27I andV37I).Genotyping withthese four polymorphisms allowed normalJapanese alleles to be classified into sevenhaplotypes.All 235delC mutant alleles iden-tified in four patients resided only on hap-lotype type 1.These findings indicate thatGJB2 mutations are also responsible forprelingual deafness in Japan.Am.J.Med.Genet.90:141145,2000.2000 Wiley-Liss,Inc.KEY WORDS:connexin 26;GJB2;prelin-gual deafness;mutation;polymorphism;JapaneseINTRODUCTIONHearing loss is the most frequent inherited sensorydisorder in humans,and inherited deafness can beclassified as nonsyndromic or syndromic deafness.Nu-merous loci(50)for nonsyndromic deafness have beenfound in the last 5 years Van Camp and Smith,1999.Recent progress in research on deafness genes revealed13 different genes for nonsyndromic deafness Avra-ham,1998;Kubisch et al.,1999;Yasunaga et al.,1999.The GJB2 gene encodes the connexin(Cx)26 mol-ecule,which is a component of the gap junctions.Gapjunctions connect adjacent cells,allowing small mol-ecules to pass from one to the next and existing on theepithelial supporting cells surrounding the sensoryhair cells of the cochlea and the fibrocytes lining thecochlear duct Kikuchi et al.,1995.The GJB2 genewas the first to be associated with autosomal recessivenonsyndromic sensorineural deafness Kelsell et al.,1997.To date,a number of GJB2 mutations have beendescribed in the Mediterranean European Zelante etal.,1997,Israeli-Arab Carrasquillo et al.,1997,American Kelley et al.,1998and Ashkenazi Jewishpopulations Morell et al.,1998,indicating that GJB2mutations are remarkably common as a cause of up to50%of prelingual(early-childhood)deafness in thesepopulations.A 30delG mutation(also known as35delG)was identified to be particularly common inthe European and American white populationsZelante et al.,1997;Estivill et al.,1998.However,asno such mutation has been found in the Asian or blackpopulations,the significance of GJB2 mutations inJapanese patients has remained unknown.We examined prelingual deafness patients,postlin-gual sensorineural hearing loss(SNHL)patients,andnormal individuals in the Japanese population by di-rect sequencing of the GJB2 gene.We also determineda haplotype association of identified mutations and thecarrier frequency in the general population.*Correspondence to:Dr.T.Kudo,Department of Otorhinolar-yngology,Head and Neck Surgery,Tohoku University School ofMedicine,1-1 Seiryo-machi,Aoba-ku,Sendai 980-8574,Japan.E-mail:kudoorl.med.tohoku.ac.jpReceived 14 June 1999;Accepted 27 September 1999American Journal of Medical Genetics 90:141145(2000)2000 Wiley-Liss,Inc.MATERIALS AND METHODSPatients and Control SubjectsWe examined three groups of patients or individualsin the Japanese population.Group 1 included 39 unre-lated individuals with prelingual deafness(onset under3 years of age,23 males and 16 females),and 15 ofthem had family histories of deafness,which appearedto be inherited in autosomal recessive modes.Group 2consisted of 39 unrelated patients with postlingual pro-gressive bilateral sensorineural hearing loss(13 malesand 26 females).Their ages of onset of deafness rangedfrom 3 to 30 years.The patterns of audiograms were asfollows:15 patients showed sensorineural hearing lossat high frequency,two at middle frequency,three atlow frequency,13 at all frequency,and six of profounddeafness.Fourteen patients had family histories ofhearing impairment.Autosomal dominant inheritancewas suggested in nine cases,and autosomal recessiveinheritance was suggested in five cases.Group 3 wascomposed of 203 unrelated individuals including 95males and 108 females showing normal hearing.In allthe three groups,their medical and family historieswere obtained through a questionnaire and interview.No one had medical histories of thyroid disease,heartdisease,neuromuscular disease,or blindness.Patientswho had possible environmental etiology,i.e.,viral in-fections,meningitis,or toxic drugs,were not includedin this study.Otological examinations,including otos-copy and audiometrical assessment were also per-formed.Informed consent was obtained from all theindividuals examined.Sequence AnalysisGenomic DNA was extracted from peripheral bloodleukocytes of the individuals to be examined.Fourpolymerase chain reaction(PCR)primer pairs were de-signed to cover the entire coding region of GJB2(TableI).The PCR conditions were as follows:40 cycles ofdenaturation at 94C for 30 sec,annealing at 60C for30 sec,and extension at 72C for 30 sec.PCR productswere electrophoresed in 2.5%low melting-point aga-rose gel,excised,and purified using a QIAEX II GelExtraction kit(QIAGEN,Hilden,Germany).The prod-ucts were sequenced directly using a DNA SequencingKit(PE Applied Biosystems,Foster City,CA)andABI Prism 310 Genetic Analyzer(PE Applied Biosystems).Sequence analysis was performed in all mem-bers of groups 1 and 2 and in 63 individuals in group 3.Detection of 235delC by RestrictionEnzyme DigestionThe entire coding region of GJB2 was amplified withthe primer pair Cx26-1F and Cx26-4R(Table I).PCRproducts were digested with the restriction endonucle-ase ApaI after ethanol precipitation.The digested PCRfragments were analyzed through agarose gel electro-phoresis.Haplotype AnalysisThe allele frequencies and haplotypes of four poly-morphisms in GJB2 were examined in 63 normal Japa-nese individuals as well as in patients who had GJB2mutations.The entire coding region of GJB2 contain-TABLE I.Oligonucleotides Used in This StudyProbeSequence(5838)Cx26-1FTGTGTGCATTCGTCTTTTCCAGCx26-1RTGGGCTGGACACGAAGATC-Cx26-2FATCACTACTTCCCCATCTCCCx26-2RTGCATGGAGAAGCCGTCGTCx26-3FGAAGGTCCGCATCGAAGGCTCCx26-3RTGGGCCGGGACACAAAGCAGCx26-4FCATGTACGACGGCTTCTCCCx26-4RGGTTGCCTCATCCCTCTCATDL16-MFGCAGCCAGCTACGATCADL16-W-GCAGCCAGGCTGCAAGA235DLC-MFTATGGGCTTGCAGCTGA235DLC-WTATGGGCCCTGCAGCTG136X-MFTGGACCTAAACAAGCAG136X-WTGGACCTACACAAGCAGFig.1.Nucleotide sequences of GJB2 mutations identified in patientswith childhood deafness.A:A 16 bp-deletion encompassing nucleotide 176191 of the GJB2 gene in a patient.The patient is heterozygous for themutation and shows characteristic“double”sequences,normal sequencesuperimposed by the mutant sequence.B:Deletion of C residue at nucleo-tide position 235.This patient is homozygous for 235delC.C:Substitutionof C residue at 408 with A,which produces termination codon.The patientis a compound heterozygote for Y136X and 176-191del(16).142Kudo et al.ing polymorphisms was amplified and subcloned into aplasmid vector pCR-TOPO using a TOPO TA-cloningkit(Invitrogen,Carlsbad,CA).Individual clones wereisolated and sequenced to determine haplotypes involv-ing four nucleotide polymorphisms.Mutation ScreeningIn addition to direct sequencing of GJB2 in the 63normal individuals,we screened 140 unrelated normalJapanese individuals for the following three mutationsby allele-specific oligonucleotide(ASO)hybridization:176-191del(16);235delC;andY136X.PCR was used toamplify a DNA fragment containing the three muta-tion sites with primers Cx26-1F and Cx26-4R(Table I).Amplified DNA was alkaline-denatured with 0.32 N ofNaOH and immobilized on a GeneScreen Plus nylonmembrane(NEN Life Science Products,Boston,MA)by ultraviolet irradiation.The membrane was hybrid-ized with each of three fluorescein isothiocyanate-labeled ASO probes:DL16-MF for the 176-191del(16)mutation site,235DLC-MF for the 235delC mutationsite,and 136X-MF for the Y136X mutation site(Ta-ble I)in a hybridization solution containing 10%dex-tran sulphate sodium salt,1%sodium dodecyl sulfate(SDS),0.05 M Tris HCl(pH 7.5),and 10-fold excesseach of the unlabeled competitor oligonucleotides(DL16-W,235DLC-W,and 136X-W)(Table I)at 40Cfor 12 hr,washed in 20 SSC/0.1%SDS at 37C fourtimes and scanned with a Molecular Imager FX(Bio-Rad laboratories,Hercules,CA).RESULTSAmong the 39 individuals with childhood deafness(group 1),we found three novel GJB2 mutations in fivepatients(Fig.1,Table II).A 235delC mutation wasobserved in three patients in homozygous state and inone patient in heterozygous state.This deletion causesframeshift at codon 79,resulting in termination atcodon 81.The 235delC mutation was readily detectedby ApaI digestion of amplified PCR products(Fig.2).A16-bp deletion,176-191del(16),was found in two pa-tients.This deletion causes frameshift at codon 59,re-sulting in termination at codon 75.A nonsense muta-tion 408CA(Y136X),which results in premature ter-mination,was detected in one patient.We did not find30delG,the common mutation in Caucasians,in any ofour patients.In contrast to group 1,no mutation wasidentified among the 39 patients with progressive post-lingual SNHL(group 2).In group 3(63 normal indi-viduals),we found a female carrier of 235delC,but shehas no family history of childhood deafness.In all thethree groups of individuals examined,there were fourTABLE II.Summary of Patients With GJB2 MutationsPatientGenderAffectedfamily memberMutationHaplotypeAllele1/allele 21MaleOne sister235delC/235delCType 1/type 12Female235delC/235delCType 1/type 13FemaleTwo sibs235delC/235delCType 1/type 14Female176-191del(16)/235delCType 1/type 15MaleFour sibs176-191del(16)/Y136XType 1/type 1Fig.2.Detection of the 235delC mutation by ApaI digestion.Amplified PCR products were digested with ApaI and subjected to agarose gel electro-phoresis.Lane M,DNA molecular size marker;lane 1,a 235delC homozygote;lane 2,a 235delC heterozygote;and lane 3,normal alleles.GJB2 Mutations in Japanese Deafness143nucleotide polymorphisms that cause an amino acidsubstitution.Two of them(341AG and 608TC)were novel,whereas the other two(79GA and109GA)have already been described Kelley et al.,1998.Amino acid substitutions caused by 79GA,109GA,341AG,and 608TC were V27I,V37I,E114G,and I203T,respectively.The V27I,V37I,E114G,and I203T polymorphic al-leles were designated as A1/A2,B1/B2,C1/C2,andD1/D2,in which allele 1 indicates no substitution andallele 2 the presence of substitution(Table III).Se-ven haplotypes were observed in the 63 normal indi-viduals(Table IV).All ten mutant alleles in GJB2 werefound to be associated with the type-1 haplotype(A1B1C1D1).Among the 140 healthy people tested in the mutationscreening,we found one carrier of the 235delC muta-tion and one carrier of the 176-191del(16)mutation.There was no Y136X mutation carrier.When combinedwith the results of sequence analysis of the 63 healthypeople,three Cx26 mutation carriers,two 235delC car-riers,and one 176-191del(16)carrier,were identified ina total of 203 apparently healthy individuals.DISCUSSIONWe have found three mutations in the GJB2 gene inJapanese patients with childhood deafness:two frame-shift mutations,235delC and 176-191del(16),and onenonsense mutation,Y136X.Each of the three muta-tions results in truncation of the protein and may dis-rupt the recycling of endolymphatic potassium ions.These three mutations have been listed in a website(The Connexin 26(GJB2)Deafness Homepage,http:/www.iro.es/cx26deaf.html,by Usami et al.,unpub-lished data).Among these three mutations,the235delC was most frequently observed in the patientswe studied(7 of 10 mutated alleles).However,we didnot find the 30delG allele either in the patients or inthe healthy individuals examined.In Caucasians,the30delG allele has been determined to be the most com-mon mutation causing nonsyndromic recessive prelin-gual deafness.Morell et al.1998 suggested that the30delG may not be of a single origin but occurs at amutation hot spot that is associated with a string of sixguanine residues at this site,because the mutant30delG was associated with various haplotypes.Shouldthis be the case,the 30delG allele could also be a com-mon mutation in the Japanese.To determine whetherthe 235delC mutation has a single origin or is causedby recurrent mutations in the population,we deter-mined haplotypes involving the four nucleotide poly-morphisms.All the mutant alleles were associatedwith type-1 haplotype,being in favor of a hypothesisthat the mutation has a single origin.However,be-cause type-1 haplotype is most common(approximately50%)in the Japanese,the characterization of addi-tional patients will be required to clarify the origin ofthe mutation.We also examined GJB2 mutations in patients withpostlingual progressive SNHL,because connexin 31,which belongs to the connexin family,was demon-strated to be responsible for autosomal dominant,post-lingual progressive sensorineural hearing loss Xia etal.,1998.However,no mutation in GJB2 was detectedin Japanese patients with postlingual hearing loss.The present study suggests that GJB2 mutations areresponsible for approximately 12%5 of 39 patients)ofprelingual deafness in Japan.Most mutations originat-ed from either 235delC or 176-191del(16).The rela-tively high prevalence of the 235delC mutation and theavailability of simple DNA diagnostic method may fa-cilitate genetic counseling in Japan.REFERENCESAvraham KB.1998.Hear come more genes!Nat Med 11:12381239.Carrasquillo MM,Zlotogora J,Barges S,Chakravarti A.1997.Two differ-ent connexin 26 mutations in an inbred kindred segregating non-syndromic recessive deafness:implications for genetic studies in iso-lated populations.Hum Mol Genet 6:21632172.Estivill X,Fortina P,Surrey S,Rabionet R,Melchionda S,DAguma L,Mansfield E,Rappaport E,Govea N,Mila M,Zelante L,Gasparini P.1998.Connexin-26 mutations in sporadic and inherited sensorineuraldeafness.Lancet 351:394398.Kelley PM,Harris DJ,Comer BC,Askew JW,Fowler T,Smith SD,Kim-berling WJ.1998.Novel mutations in the connexin