北大生物化学完整chapter7.pptx

NucleotidesDeoxyribonucleic Acids(DNA)Ribonucleic Acids(RNA)Daochun KongThe College of Life SciencesPeking UniversityDeoxyribonucleic Acids(DNA)In 1868,Friedrich Miescher,a Swiss biologist,isolated a phosphorus-containing substance from the nuclei of pus cells(leukocytes),which he called“nuclein”.He further found that the“nuclein”consisted of two portions.One portion is acidic,which we now know as DNA.The other portion is basic,which are mostly histone proteins.Thereofre,the“nuclein”Miescher isolated was actually chromatin.Later,he found that a similar substance in the heads of salmon sperm cells.1.The Discovery:2.DNA,the Genetic Substance:1).DNA was suspected to be genetic material,but,there was more reason to assign this role to proteins.Proteins were thought to be larger,more complex (composed of twenty different amino acids),and therefore were more suitable for a genetic role.DNA was thought to be just a repeating polymer of one kind of tetranucleotide unit.It was just about seventy years ago,in1930s,DNA was widely believed to exist only in animal cells,and RNA was in plant cells.Plant and animal cells were sometimes distinguished based on this chemical feature.2).In 1928,Frederick Griffith discovered the phenomenon of transformation in bacteria Streptococcus pneumoniae has two forms,Slimy colonies(virulent S strain)forms mucous capsules,it kills mice.But,heat-killed strain does not kill mice.Rough colonies(non-virulent R strain)lacks capsules,it does not kill mice.Mixed heat-killed S-strain with live R-strain,resulting organisms killed mice.Conclusion:some chemical in cells of S strain is stable in heat treatment,retains genetic information,is able to transmit that information to R-strain bacteria,convert them to S.3).In 1944,Avery,MacLeod,and McCarty found that DNA prepared from a virulent strain of pneumococcus could transform a nonvirulent strain of this organism into a virulent one.Virulent bacteriaInjectionMouse diesNonvirulent bacteriaMouse livesAvery OT,MacLeod CM,McCarty M(1944)J.Exp.Med.79:137.Nonvirulent bacteriaDNA from virulent bacteria DNA carried a genetic message from one type of cells could be assimilated and expressed by another type of cells.Conclusion:Argument:At that time,not everyone accepted Avery et als conclusion.The critics attacked that,a.The DNA was possibly contaminated by slight amount of proteins that was responsible for the observed transformation.b.DNA may be genetic substance just in bacteria.What are your experiments to ease or eliminate these critics doubts?4).In 1952,Alfred D.Hershey and Martha Chase discovered that it was bacteriophage T2 DNA that entered host cell,E.coli,and carried genetic information for phage replication.At that time,it was already known,a.Bacteriophage contains only DNA and proteins.b.Phage proteins do not have phosphorus P,but do contain sulfur S in amino acids.DNA does not have S,but lots of P.Hershey and Chases experiment5).In 1953,Watson and Crick,based on experimental evidences provided by the other people,suggested a model for structure of DNA-a complementary,double stranded,and helical structure of DNA.This model was proved correct several years later.Based on the above and other studies,it is finally demonstrated that DNA is indeed genetic substance.It has two discrete functions-One is to carry genetic information that brings about the specific phenotype of the cell;Another is its own replication.1.How many kinds of nucleic acids?2.Chemical constituents of nucleic acids3.Structure of nucleic acids?4.Chemical properties of nucleic acids?3.Chemistry of Nucleic AcidsTwo Kinds of Nucleic Acids in All Organisms1.DNA-Deoxyribonucleic acids2.RNA-Ribonucleic acids1.DNA is a long linear polymer composed of four kinds of monomer units called deoxyribonucleotides(A,G,T,C)linked to each other in a chain.DNA 5-AGTCCCTAGGACTATTTAAAACCTGGAGAGT-32.Single-stranded DNA(ssDNA)and double-stranded DNA(dsDNA).In nature,most of DNA is in the form of dsDNA.RNA1.RNA is also linear polymers composed of four types of ribonucleotides(A,G,C,U).5AGCUAAGUCCUUUGGGAACCCAAGGUUAACC32.Ribosomal RNAs(rRNA)Messenger RNAs(mRNAs)Transfer RNAs(tRNAs)and Other RNA molecules Chemical Structure of NucleotidesAlexander R.Todd(1954)chemical structure of the nucleic acids.PNAS.40:748-755 Differences of Nucleotides between DNA and RNADeoxyadenylate Deoxyguanylate Deoxythymidylate Deoxycytidylate Deoxyribonucleotides Adenylate Guanylate Uridylate Cytidylate RibonucleotidesSome Rare Bases in DNA and RNA 5-Methylcytidine N6-MethyladenosineN2-Methyladenosine 5-Hydromethylcytidine Inosine Pseudouridine7-Methylguanosine 4-ThiouridineRare bases in DNA Rare bases in RNADNARNADNA&RNA Polymer Individual nucleosides are joined together by phospho-diester bonds,not ether or pyrophosphate linkages.Levene&Simms(1925,1927)JBC.65:519;70:327.4.Structure of DNA Erwin Chargaff1).Erwin Chargaff measured amounts of four nucleotides in DNA from different organismsCompositions of deoxyribonucleotides in Sea-Urchin DNARatios of deoxyribonucleotides in Sea-Urchin DNACompositions of deoxyribonucleotides in Salmon Sperm DNARatios of deoxyribonucleotides in Salmon Sperm DNA Dr.Chargaff discovered that,a.The amounts of deoxynucleotides A,G,C,T in DNA varied in different organisms.This result rejected the tetranucleotide hypothesis and demonstrated the potential for the existence of a large number of species of DNA.b.The ratios of A to T and G to C are one or very close to one.This ratio is called Chargaffs ratio or rule.These base regularities suggested the existence of some kind of base pairing.2).Dr.Donohue,a theoretical chemist,suggested that that at physiological condition,pH 7.0,four bases are at keto form,not enol form.Jerry Donohue:Keto form Keto,enol enol formKeto or enol form of basesDeoxyadenylate Deoxyguanylate Deoxythymidylate Deoxycytidylate Deoxyribonucleotides Adenylate Guanylate Uridylate Cytidylate RibonucleotidesG,C,T,and U all can have keto or enol form if pH changes.But,the keto form of all bases predominates at pH 7.0.Potential hydrogen-bonding donor and acceptor sitesPossible base pairsDonohue j.(1956)hydrogen-bonded helical configurations of polynucleotides.PNAS.42:60-65Most possible base-pairings in deoxyribonucleic acids Rosalind Franklin&Maurice WilkinsX-ray Diffraction of DNA3).X-ray diffraction pattern of B form of DNABased on information from x-ray diffraction pattern of DNA,Dr.Franklindeduced that,X-ray diagram of DNA shows the features characteristic of helical structures.DNA fibers have two periodicities.A major one of 3.4 A a secondary one of 34 AThe diameter of the suggested helical structure of DNA is 20 A.(A:Angstrom)Dr.Franklin also suggested that,a.The sugar-phosphate groups were outside.b.The backbone of the A form of DNA is antiparallel.James D.Watson&Francis H.C.CrickWatson and Crick proposed a model of double helix structure for DNA Watson&Crick(1953)Molecular structure of nucleic acids.171:737-738.Two helical DNA chains wound around the same axis to form a right-handed double helix.Sugar and phosphate form the backbone of the helix and are on the outside of the helix.The purine or pyrimidine bases from both strands are stacked inside.The rings of bases are perpendicular to the long axis.Due to helical structure,there are two grooves on the surface of the duplex.The distance between two neighbourring bases is 3.4 A.Per turn has 10.5 bases,36 A.Two strands are antiparallel.A pairs with T,and G pairs with C.They are linked by hydrogen bonds.Watson and Cricks model for structure of DNA states:A Scheme for spatial positions of chemical groups in DNAPositions of hydrogen bonds in AT and GC base pairDNA replication suggested by Watson and CrickOldNewMeselson-Stahl experiment15N-DNA is about 1%greaterthan 14N-DNA.They can beSeparated by centrifugation to Equilibrium in a cesium chlorideDensity gradient.Other forms of helical DNA structuresNoWater water GCGCStructure of RNANucleotide composition of RNA single-stranded RNA chain.RNA,unlike DNA,has no regular secondary structure.But,it tends to have a right-handed helical conformation dominated by base-stacking interactions.RNA Internal double helical structureA typicalRNA moleculeHairpin and CruciformAbsorption Spectra of NucleotidesMonitor DNA denaturation by UV absorption Hypochromic effect:When two complementary DNA strands are paired,the absorption of UV light decreases.Hyperchromic effect:UV light absorption increases when two paired DNA strands separate.Tm:Melting point-a temperature point at which the UV absorption reaches to 50%maximum value due to DNA denatu-ration.Tm value is directly proportional to the percentage of GC in total nucleotides.RNA is labile under alkaline conditionsNucleic Acid ChemistryDenaturation and renaturation of DNAAT-rich regions are easily unwound.DNA replication origins are often AT-rich sequences where DNA synthesis starts.The essential consensus sequences in the promoter regions of genes are AT-rich sequences.-TTGACA-TATAAT-35 region -10 region RNA start site DNA sequencing by the Sanger method Automating DNA sequencingDNA Synthesis