PrimerBLAST-操作说明.ppt

Click to edit Master title style,Click to edit Master text styles,Second level,Third level,Fourth level,Fifth level,*,GeXP Gene Expression Multiplex Design:,Using NCBI Primer-BLAST to design high performance,gene-specific primers for an XP-PCR multiplex,Updated:March 07,2011,1,Two Design Strategies,Use Accession Numbers or Proprietary Genes to create gene-specific primers for amplicons 105-350 nucleotides in length,The,shotgun approach,is an efficient method to use when little or no genome information is available for the organism of interest.,Little or no homology,pseudogene or transcript variant information,No SNP information,No intron/exon boundaries,The,strategic approach,is recommended when a model organism is used and/or there is sufficient genomic data available in NCBI for Primer-BLAST to scan primers for:,Homology and/or transcript variants,SNP,Intron/exon boundaries are known,12,2,Accession Numbers,Strategic Approach,NCBI Primer-BLAST design,Pre-design considerations,Order primers with universal tags and evaluate primers,in vitro,3,Pre-design considerations,Choosing the gene and accession number,Use only mRNA accession numbers,Amplicon length and space between peaks,Design using NCBI Primer-BLAST,Amplicon lengths,Design primers to detect all transcript variants(if not specified)or a unique transcript variant(if specified),Design primers to avoid amplifying transcribed pseudogenes,Design intron-spanning primers when possible,Exclude SNPs from primers,Strategic Approach,4,Advanced Primer Design Workflow,Obtain mRNA accession numbers or use gene sequence,Check gene for transcript variants,pseudogenes and intron information:,Entrez Gene,(See Specific Design Considerations),Design primers using,Primer BLAST,Enter primer name,fragment size,gene name into multiplex TDF file template,Determine the desired length of amplicon,(without universal tags),5,1.Choosing an,Accession Number,A single gene can be represented in the NCBI database by multiple accession numbers,mRNA,Always use,reference sequence,(,RefSeq,)(NM_XXXXXX)from the Database,Use caution with other mRNA accession numbers,-partial sequences,-mutations,-ESTs,Do not use an accession number for genomic sequences,2.Ensure the following for each accession number that is chosen:,Correct gene is chosen,Multiple names and aliases,Different genes can have similar names,Species of interest,If non-RefSeq accession number is used,Verify that the sequence contains,only,the letters,A,T,G,C,or,N,Pre-Design Considerations,6,Amplicon Length,Design amplicons such that each fragment is,no less than 5 nucleotides apart,from its nearest neighbor.,This allows for variation in migration to meet the minimum peak separation distance of 3 nucleotides.,Design amplicons between 105 350 nt,(without universal tags),142 387 nt with universal tags,Start with small fragment size and work toward larger fragment size,Note,:For FFPE samples,design amplicons between 105-160 nt(without universal tags),the recommended total number of fragments in a panel is twenty or less.,Pre-Design Considerations-Continue,7,Gene Information,Intron and Exon Information,Transcript Variants Information,Pseudogenes Information,Pre-Design Considerations-Continue,8,1.,Choose the,Gene,database,2.,Enter gene name or accession number,3.Click Search,NCBI web or directly go to www.ncbi.nlm.nih.gov/gene/,Step1:Getting Gene Information,9,Get the alias(es)and a summary,Example:NM_01825,10,View the transcripts and reference sequences,ELP2 contains a single transcript with 22 exons,Each green bar represent an exon.,ELP2 located at the Chromosome 18,11,Step 2:Checking for homology and pseudogenes,Perform a species-specific query,Blast human genome if it is a human gene,Go to blast.ncbi.nlm.nih.gov/Blast.cgi,12,Enter the accession#here,Select“reference only”database,Click“Begin Search”,13,Click“View Report”,Click View Report to view gene information,14,Only one hit,theres no high homologous region or pseudogenes.,Click on the link to go to the map view and intron-exon information.,Report view page,Black hash marks indicate exon-exon boundaries,NM_018255,15,Go to,blast.ncbi.nlm.nih.gov/Blast.cgi,Scroll down to find the Specialized BLAST,click Primer BLAST,Step3:,Design Gene-Specific Primers,16,NCBI Primer-BLAST,This program will accomplish the following when the parameters are set properly:,Check for specificity both within a species and between species(must add species),Include or exclude transcript variants,Exclude SNPs from the primer binding sites,Create intron-spanning primers and/or exon-junction primers,Allows for design to specific regions within the gene or using a pre-designed primer sequences,Avoids low complexity primer binding regions,Note:Generally the more restrictions that are placed on the primer selection program,the fewer primers binding sites will be available,This program does NOT:,Check for repeat sequences within the amplicon which may lead to stutter,Check for pseudogenes,17,Design Gene-Specific Primers with NCBI,Primer-BLAST,3.(optional)Specify specific nucleotide regions for the forward and reverse primers,2.Enter pre-designed primers(if any,optional),1.Enter accession number or FASTA sequence(mandatory),18,Primer-BLAST continued,4.Specify product size(mandatory)range=105 350 nt for XP-PCR,6.Use default Tm settings,105,105,5.Specify the#of primer sets to return(optional),19,8.Verify specificity by checking the box and entering the species(recommended),9.Include splice variants by checking this box(optional).Try to exclude splice variant by leaving it blank.,7.Check this box to design intron,spanning primers),Recommended 500 as Min,Click Advanced parameter for more options,20,12Change Default Salt correction formula and Thermodynamic Parameters as indicated below,Salt=Schinderkraut&Lifso 1965,Tm=Breslauer et al.1986,13.Click“Get Primers to obtain,results,11.Exclude SNPs from the primer binding site.,21,Results,22,Primer Design continue,Add the universe taq sequence to each of the gene specific primer sequence as the final primer sequence,Example:,Forward Sequence with the Universal Taq Sequence,AGGTGACACTATAGAATA,TGATCGGGTCTTCCTTCATC,Reverse Sequence with Universal Taq Sequence,GTACGACTCACTATAGGGA,GCCATTAAGGCCCTTCTTTC,The designed fragment size is the gene specific size plus 37bp of the universal taq,eg,the designed size is 105bp,the expected product size is 142bp.,Order primers with Universal Tags,except KanR(in buffers),23,1.Keep the all header columns information unchanged.,2.Change a new multiplex name(cell A2)when the multiplex information was modified.,3Primer name,GeXP product size,Gene Name and Accession number information are essential.,4.Enter same information for both Gene Name and Accession number columns.,5.Use the actual CEQ fragment size in the product size with universal taq column,6 Row 3 has to be empty,7.Keep at the last line of primer name.,Create a Multiplex from a TDF file template,24,What is the TDF File?,The TDF file contains the multiplex information and that links the X-Profiler Analysis with the imported GeXP csv data.,A multiplex can be uploaded into eXpress Profiler from administrator account with a,valid*,TDF file.,Unique Multiplex Name(cell A2 in Excel spreadsheet),Row 3 has to be empty,Keep all the column header unchanged.,Mandatory fields to be filled:Primer Name,Gene Name,Accession Number,Product Size w/Universals(use GeXP final product size easier for binning!).,Enter same information in the Gene Name and Accession Number(Can be gene name or accession number).,Primer name do not include()(),otherwise the quotation marks will created when you modified the TDF,the TDF will fail to be imported.,25,Specific Primer Design Considerations,Targeted specific transcription variants,Excluded pseudogenes,26,Example:Targeted Primer Design for BIRC5,www.ncbi.nlm.nih.gov/gene/,27,Target the 5 exon1-2 to capture three variants,Go to Nucleotide home,www.ncbi.nlm.nih.gov/nuccore,enter accession#,BRC5 gene has three transcript variants,Click Graphics,28,Go to NCBI Nucelotide home,www.ncbi.nlm.nih.gov/nuccore,enter accession#,Graphic to view exon information,Example:NM_001012271,five exons,29,Right click the exon bar to view exon positions,30,Has to reduce the intron,size in order to design,primer between exon1-2.,Primer Designed:Specific the forward primer and reverse positions,31,Primer Designed:Selected“Allow to amplify splice variants,32,Results,33,Primers targeted three transcript variants,34,Design primers to regions unique to the real mRNA.,Design Primers excluding the Pseudogenes,35,Why design primers spanning an intron?,To avoid genomic DNA interference from,Samples resistant to DNase,Samples too small to be treated with DNase,Single cell analysis,To minimize or eliminate RT minus control,Saving for reagents and time,Note:This step is optional or sometimes impossible step for certain multiplex panel,Optional when DNase treatment will be performed routinely,Impossible when gene/variant specificity is only in the 3UTR(no introns).,36,Plex B RT minus control,Each primer pair was designed on different exons to avoid interference from genomic DNA contamination.,No false positive,37,Plex A RT minus control,Multiple false positives/false signal,Primers were designed without spanning intronMultiple false positives in RTminus although samples were DNase treated.,38,Other Considerations,Designing primers for gene family members,Designing primers for splice variants,Choosing quality reference(housekeeping)genes,XP-PCR Primer Specifications,39,Design gene-specific primers for gene family members,When gene family members are involved,proprietary sequences should be created using non-homologous sequences.,If a block of non-homologous sequence is not available,individual primer sets should be designed prior to the multiplex design.The primer should have its 3 end land in non-homologous region.,40,Design gene-specific primers for gene family members,when using proprietary sequence is not an option,Perform alignment,Pick a reverse primer that has its 3 end land on non-homolog region,Paste the primer sequence into right primer window,Pick a forward primer that has its 3 end land on non-homologous region,Paste the primer sequence into left primer window,Click Execute,This task can also be performed via Primer-BLAST at,www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi,41,Example:design gene-specific primer regions for CYP6Z1,Alignment of CYP6Z family,42,Primer Design for Splice Variants,43,mRNA,One set of primers target common exons and amplify multiple splice variants,This will only work if exon 2 is small enough(200 nt),1,2,3,4,v1,1,3,4,v2,1,2,3,4,120 nt,300 nt,Amplicon,44,Common reverse primer and specific forward primers amplify multiple transcript variants,1,2,3,4,Now it doesnt matter how big exon 2 is.,Design an exon 1-exon 3 junction forward primer for v2,120 nt,nt,125,1,2,3,4,v1,1,3,4,v2,mRNA,Amplicon,45,Specific reverse and forward primers amplify a single transcript variant,4,1,2,3,Design an exon 2-exon 3 junction,reverse,primer for v1,1,2,3,4,v1,1,3,4,v2,100 nt,Does not amplify,mRNA,Amplicon,46,Choosing Quality Reference Genes,Equivalent expression of each reference gene over all samples(tissues,treatments,time points)examined,GeXP Human ReferencePlex,No psuedogenes present,or,target a unique region in the reference gene,Use multiple(3+)reference genes for normalization,Add more than and then choose which ones to use for study,47,Housekeeping(Reference)Genes Primers available,TBP(NM_003194)170bp,212bp,PSCM4(NM_153001)143bp,271bp,HRT1(NM_000194)234bp,CCNG1(NM_004060)278bp,GUB2(NM_000181)198bp,RPLP0(NM_053275)115bp,127bp,GAPDH(NM_002046)248bp,Mouse,mTBP(NM_013684)151bp,mGUB2(NM_010368)238bp,mCCNG1(NM_009831)281bp,mGAPDH(NM_008084)349bp,Human,48,GAPDH has many pseudogenes,It is impossible to design primers around all the pseudogenes.,49,XP-PCR Primer Specifications,Feature,min,optimal,max,unit,Tm,*,57 6063,o,C,Length17 2023 nt,Amplicon Size105 -350nt,*,The default values for Table of thermodynamic parameters and Salt correction formula(under advanced parameters)have been changed in NCBI Blast to values recommended in primer3 program.Table of thermodynamic parameters is changed from,Breslauer et al.1986,to SantaLucia 1998 and Salt correction formula is changed from,Schildkraut and Lifson 1965,to SantaLucia 1998.As a result,the default Tm values for your primers will be different from previous calculation.If you would like a different value for future use,you can save your custom parameters using Save search parameters at the top of the page with Tm=,Breslauer et al.1986,and Salt correction=,Schildkraut and Lifson 1965,SNPsNo more than 1 or 2 SNPs in 5 end,no SNP in the 6nt closest to 3end,RepeatsNo more than 6 mono-or di-nucleotide repeats,or several shorted repeats broken by single alternative nucleotide,in the amplicon(visual check or repeat mask in amplicon BLAST),SpecificityPrimers are specific to intended target-consider homologous genes,transcript variants and pseudogenes,Spacing Minimum of 5nt designed between each peak as they may end up closer due to CE.No less than 3nt ACTUAL space between peaks.,Intron-spanningDesign primers on two separate exons that span a large intron.This is optional,but advised for samples where complete DNase digestion is not likely,50,Shotgun Approach,Proprietary Genes Information,BLAST QC with NCBI,(if possible),Redesign individual primers,(as necessary),Primer 3 inputs SW,frodo.wi.mit.edu/primer3/,Order primers with universal tags and evaluate primers,in vitro,51,1.Enter FASTA sequence,2.Enter the desired size range,3.Click“Pick Primers,52,BLAST QC with NCBI,blast.ncbi.nlm.nih.gov/Blast.cgi,53,Paste FASTA,Click Blast,54,Checking SNP,BLAST QC with NCBI,blast.ncbi.nlm.nih.gov/Blast.cgi,55,