慢病毒包装教程(Lentivirus-Packaging-and-Production).doc

Lentivirus Packaging and Production
The laboratories of Didier Trono (EPFL) and Robert Weinberg (Whitehead Institute) have deposited plasmids for the production of lentiviral particles. These plasmids can be used with many lentiviral vectors, including The RNAi Consortium shRNA vectors being distributed by Sigma (i.e. MISSION shRNAs) and Open Biosystems (i.e. TRC shRNAs).
Overview
For producing lentiviral particles, you typically need three components: 1) a lentiviral vector, such as pLKO.1 or pLVTHM, containing the shRNA or transgene, 2) a packaging vector, such as psPAX2 or pCMV-dR8.2 dvpr, and 3) an envelope vector, such as pMD2.G or pCMV-VSVG.
For most applications, you can produce viral particles by transient transfection of 293T cells with a 2nd generation packaging system (e.g. packaging plasmid psPAX2 and envelope plasmid pMD2.G).
2nd Generation Packaging System
In general, lentiviral vectors with a wildtype 5' LTR need the 2nd generation packaging system because these vectors require TAT for activation. All lentiviral vectors from the Trono or Aebischer lab require packaging with a 2nd generation system.
Below are two 2nd generation systems. Lentiviral plasmids based on pLKO.1 can be packaged with either system, although the first system has been reported to produce higher titer. See Addgene's pLKO.1 Protocol for producing lentiviral particles.
2nd generation system deposited by the Trono lab:
ID</FONT< td>
Plasmid
Description
12260
psPAX2
2nd generation packaging plasmid for producing viral particles. psPAX2 contains a robust CAG promoter for efficient expression of packaging proteins. Trono lab and Aebischer lab lentiviral vectors require psPAX2. Produces higher titer than pCMV-dR8.2 dvpr.
12259
pMD2.G
Envelope plasmid for producing viral particles
2nd generation system deposited by the Weinberg lab:
ID</FONT< td>
Plasmid
Description
8455
pCMV-dR8.2 dvpr
2nd generation packaging plasmid for producing viral particles
8454
pCMV-VSVG
Envelope plasmid for producing viral particles
3rd Generation Packaging System
The 3rd generation packaging system offers maximal biosafety but is more cumbersome to use, as it involves the transfection of four different plasmids in the producer cells (two packaging plasmids, an envelope plasmid, and the lentiviral vector).
If you wish to use this system, you need to have a lentiviral vector with a chimeric 5' LTR in which the HIV promoter is replaced with CMV or RSV, thus making it TAT-independent. Examples of these vectors include pLKO.1, pLL3.7, pLB, pLenti6, pSico, pCL, and pCS. Most Aebischer and Trono Lab lentiviral vectors CANNOT be used with this system. A lentiviral vector carrying a chimeric 5' LTR can be packaged with either the 2nd or 3rd generation packaging system.
ID</FONT< td>
Plasmid
Description
12251
pMDLg/pRRE
3rd generation packaging plasmid for producing viral particles
12253
pRSV-Rev
3rd generation packaging plasmid for producing viral particles
12259
pMD2.G
Envelope plasmid for producing viral particles
More information
· Click here to browse other RNAi vectors, or search for plasmids using the search bar at the top of the page.
· Trono Lab website or Lentiweb: information and a discussion forum on cloning, packaging, and other protocols.
· Moffat J et. al. 2006. A lentiviral RNAi library for human and mouse genes applied to an arrayed viral high-content screen. Cell 124:1283-1298. (PubMed)
· Ventura et. al. 2004. Cre-lox-regulated conditional RNA interference from transgenes. PNAS 2004 Jul 13;101(28):10380-5. (PubMed)
· Naldini L et. al. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263-267. (PubMed)
· Dull et al., A Third-Generation Lentivirus Vector with a Conditional Packaging System. J. Virol. 1998 72(11): 8463-8472. (PubMed)
· Zufferey R et. al. 1997. Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo. Nat Biotechnol 15(9):871-5. (PubMed)
· Zufferey R et. al. 1998. Self-inactivating lentivirus vector for safe and efficient in vivo gene delivery. J Virol 72(12):9873-80. (PubMed)
Cell Line
The 293T cell line for producing lentiviral particles can be obtained from GenHunter.

pLKO.1 Protocol
pLKO.1 - TRC Cloning Vector
Addgene Plasmid 10878. Protocol Version 1.0. December 2006.
Copyright Addgene 2006, All Rights Reserved. This protocol is provided for your convenience. See warranty information in appendix.
Click here for a printable copy.
Table of Contents
· A. pLKO.1-TRC Cloning Vector
o A.1 The RNAi Consortium
o A.2 Map of pLKO.1
o A.3 Related plasmids
· B. Designing shRNA Oligos for pLKO.1
o B.1 Determine the optimal 21-mer targets in your gene
o B.2 Order oligos compatible with pLKO.1
· C. Cloning shRNA oligos into pLKO.1
o C.1 Recommended materials
o C.2 Annealing oligos
o C.3 Digesting pLKO.1 TRC-Cloning Vector
o C.4 Ligating and transforming into bacteria
· D. Screening for Inserts
o D.1 Recommended materials
o D.2 Screening for inserts
· E. Producing Lentiviral Particles
o E.1 Recommended materials
o E.2 Protocol for producing lentiviral particles
· F. Infecting Target Cells
o F.1 Recommended materials
o F.2 Determining the optimal puromycin concentration
o F.3 Protocol for lentiviral infection and selection
· G. Safety
· H. References
o H.1 Published articles
o H.2 Web resources
· I. Appendix
o I.1 Sequence of pLKO.1 TRC-Cloning Vector
o I.2 Recipes
o I.3 Warranty information
Back to Top
A. pLKO.1-TRC Cloning Vector
A.1 The RNAi Consortium
The pLKO.1 cloning vector is the backbone upon which The RNAi Consortium (TRC) has built a library of shRNAs directed against 15,000 human and 15,000 mouse genes. Addgene is working with the TRC to make this shRNA cloning vector available to the scientific community. Please cite Moffat et al., Cell 2006 Mar; 124(6):1283-98 (PubMed) in all publications arising from the use of this vector.
A.2 Map of pLKO.1
pLKO.1 is a replication-incompetent lentiviral vector chosen by the TRC for expression of shRNAs. pLKO.1 can be introduced into cells via direct transfection, or can be converted into lentiviral particles for subsequent infection of a target cell line. Once introduced, the puromycin resistance marker encoded in pLKO.1 allows for convenient stable selection.

Figure 1 : Map of pLKO.1 containing an shRNA insert. The original pLKO.1-TRC cloning vector has a 1.9kb stuffer that is released by digestion with AgeI and EcoRI. shRNA oligos are cloned into the AgeI and EcoRI sites in place of the stuffer. The AgeI site is destroyed in most cases (depending on the target sequence), while the EcoRI site is preserved. For a complete map of pLKO.1 containing the 1.9kb stuffer, visit www.addgene.org/10878.

Description
Vector Element
U6
Human U6 promoter drives RNA Polymerase III transcription for generation of shRNA transcripts.
cPPT
Central polypurine tract, cPPT, improves transduction efficiency by facilitating nuclear import of the vector's preintegration complex in the transduced cells.
hPGK
Human phosphoglycerate kinase promoter drives expression of puromycin.
Puro R
Puromycin resistance gene for selection of pLKO.1 plasmid in mammalian cells.
sin 3'LTR
3' Self-inactivating long terminal repeat.
f1 ori
f1 bacterial origin of replication.
Amp R
Ampicillin resistance gene for selection of pLKO.1 plasmid in bacterial cells
pUC ori
pUC bacterial origin of replication.
5'LTR
5' long terminal repeat.
RRE
Rev response element.

Figure 2 : Detail of shRNA insert. The U6 promoter directs RNA Polymerase III transcription of the shRNA. The shRNA contains 21 "sense" bases that are identical to the target gene, a loop containing an XhoI restriction site, and 21 "antisense" bases that are complementary to the "sense" bases. The shRNA is followed by a polyT termination sequence for RNA Polymerase III.
A.3 Related Products
The following plasmids available from Addgene are recommended for use in conjunction with the pLKO.1 TRC-cloning vector.
Plasmid (Addgene ID #)
Description
pLKO.1 - TRC control (10879)
Negative control vector containing non-hairpin insert.
pLKO.1 - scramble shRNA (1864)
Negative control vector containing scrambled shRNA.
psPAX2 (12260)
Packaging plasmid for producing viral particles.
pMD2.G (12259)
Envelope plasmid for producing viral particles.
Note: pLKO.1 can also be used with packaging plasmid pCMV-dR8.2 dvpr (Addgene #8455) and envelope plasmid pCMV-VSVG (Addgene #8454) from Robert Weinberg's lab. For more information, visit Addgene's Mammalian RNAi Tools page.
Several other laboratories have deposited pLKO derived vectors that may also be useful for your experiment. To see these vectors, visit Addgene's website and search for "pLKO".
Back to Top
B. Designing shRNA Oligos for pLKO.1
B.1 Determining the Optimal 21-mer Targets in your Gene
Selection of suitable 21-mer targets in your gene is the first step toward efficient gene silencing. Methods for target selection are continuously being improved. Below are suggestions for target selection.
1. Use an siRNA selection tool to determine a set of top-scoring targets for your gene. For example, the Whitehead Institute for Biomedical Research hosts an siRNA Selection Program that can be accessed after a free registration (http://jura.wi.mit.edu/bioc/siRNAext/). If you have MacOS X, another excellent program is iRNAi, which is provided free by the company Mekentosj (
A summary of guidelines for designing siRNAs with effective gene silencing is included here:
· Starting at 25nt downstream of the start codon (ATG), search for 21nt sequences that match the pattern AA(N19). If no suitable match is found, search for NAR(N17)YNN, where N is any nucleotide, R is a purine (A,G), and Y is a pyrimidine (C,U).
· G-C content should be 36-52%.
· Sense 3' end should have low stability – at least one A or T between position 15-19.
· Avoid targeting introns.
· Avoid stretches of 4 or more nucleotide repeats, especially repeated Ts because polyT is a termination signal for RNA polymerase III.
2. To minimize degradation of off-target mRNAs, use NCBI's BLAST program. Select sequences that have at least 3 nucleotide mismatches to all unrelated genes.
Addgene recommends that you select multiple target sequences for each gene. Some sequences will be more effective than others. In addition, demonstrating that two different shRNAs that target the same gene can produce the same phenotype will alleviate concerns about off-target effects.
B.2 Ordering Oligos Compatible with pLKO.1
To generate oligos for cloning into pLKO.1, insert your sense and antisense sequences from step B.1 into the oligos below. Do not change the ends; these bases are important for cloning the oligos into the pLKO.1 TRC-cloning vector.
Forward oligo:
5' CCGG—21bp sense—CTCGAG—21bp antisense—TTTTTG 3'
Reverse oligo:
5' AATTCAAAAA—21bp sense—CTCGAG—21bp antisense 3'
For example, if the target sequence is (AA)TGCCTACGTTAAGCTATAC, the oligos would be:
Forward oligo:
5' CCGGAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATTTTTTTG 3'
Reverse oligo:
5' AATTCAAAAAAATGCCTACGTTAAGCTATACCTCGAGGTATAGCTTAACGTAGGCATT 3'
Back to Top
C. Cloning Oligos into pLKO.1
The pLKO.1-TRC cloning vector contains a 1.9kb stuffer that is released upon digestion with EcoRI and AgeI.
The oligos from section B contain the shRNA sequence flanked by sequences that are compatible with the sticky ends of EcoRI and AgeI. Forward and reverse oligos are annealed and ligated into the pLKO.1 vector, producing a final plasmid that expresses the shRNA of interest.
C.1 Recommended Materials
Material
Vendor and catalog #
AgeI
New England Biolabs (NEB) #R0552S
EcoRI
NEB #R0101S
T4 DNA ligase
NEB #M0202S
NEB buffer 2
NEB #B7002S
DH5 alpha competent cells
Invitrogen #18258-012
Qiaquick gel extraction kit
Qiagen #28704
Low melting point agarose
Sigma #A9414
Luria Broth Agar (LB agar)
American Bioanalytical: #AB01200-02000
Ampicillin
VWR: #7177-48-2. Use at 100 μg/mL.
Carbenicillin
VWR: #80030-956. Use at 100 μg/mL.
C.2 Annealing Oligos
1. Resuspend oligos in ddH2O to a concentration of 20 μM, then mix:
5 μL
Forward oligo
5 μL
Reverse oligo
5 μL
10x NEB buffer 2
35 μL
ddH2O
2. Incubate for 4 minutes at 95oC in a PCR machine or in a beaker of boiling water.
3. If using a PCR machine, incubate the sample at 70oC for 10 minutes then slowly cool to room temperature over the period of several hours. If using a beaker of water, remove the beaker from the flame, and allow the water to cool to room temperature. This will take a few hours, but it is important for the cooling to occur slowly for the oligos to anneal.
C.3 Digesting pLKO.1 TRC Cloning Vector
1. Digest pLKO.1 TRC-cloning vector with AgeI. Mix:
6 μg
pLKO.1 TRC-cloning vector (maxiprep or miniprep DNA)
5 μL
10x NEB buffer 1
1 μL
AgeI
to 50 μL
ddH2O
> Incubate at 37oC for 2 hours.
2. Purify with Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.
3. Digest eluate with EcoRI. Mix:
30 μL
pLKO.1 TRC-cloning vector digested with AgeI
5 μL
10x NEB buffer for EcoRI
1 μL
EcoRI
14 μL
ddH2O
> Incubate at 37oC for 2 hours.
4. Run digested DNA on 0.8% low melting point agarose gel until you can distinctly see 2 bands, one 7kb and one 1.9kb. Cut out the 7kb band and place in a sterile microcentrifuge tube.
When visualizing DNA fragments to be used for ligation, use only long-wavelength UV light. Short wavelength UV light will increase the chance of damaging the DNA.
5. Purify the DNA using a Qiaquick gel extraction kit. Elute in 30 μL of ddH2O.
6. Measure the DNA concentration.
C.4 Ligating and Transforming into Bacteria
1. Use your ligation method of choice. For a standard T4 ligation, mix:
2 μL
annealed oligo from step C.2.
20 ng
digested pLKO.1 TRC-cloning vector from step C.3. (If you were unable to measure the DNA concentration, use 1 μL)
2 μL
10x NEB T4 DNA ligase buffer
1 μL
NEB T4 DNA ligase
to 20 μL
ddH2O
> Incubate at 16oC for 4-20 hours.
2. Transform 2 μL of ligation mix into 25 μL competent DH5 alpha cells, following manufacturer's protocol. Plate on LB agar plates containing 100 μg/mL ampicillin or carbenicillin (an ampicillin analog).
Back to Top
D. Screening for Inserts
You may screen for plasmids that were successfully ligated by restriction enzyme digestion. However, once you have identified the positive clones, it is important to verify the insert by conducting a sequencing reaction.
D.1 Recommended Materials
Material
Vendor and catalog #
DNA Miniprep Kit
Qiagen #27104
EcoRI
NEB #R0101S
NcoI
NEB #R0193S
Agarose
Sigma #A9539
D.2 Screeni