Genome-Wide Studies Reveal That Lin28 Enhances the Translation of Genes Important for Growth and Survival of Human Embryonic Stem Cells.pdf

EMBRYONICSTEMCELLS/INDUCEDPLURIPOTENTSTEMCELLSGenome-Wide Studies Reveal That Lin28 Enhances the Translation ofGenes Important for Growth and Survival of Human Embryonic StemCellsSHUPINGPENG,a,b*LING-LINGCHEN,cXIN-XIANGLEI,a,dLIYANG,cHAIFANLIN,bGORDONG.CARMICHAEL,cYINGQUNHUANGa,baDepartment of Obstetrics,Gynecology and Reproductive Sciences,Yale University School of Medicine,NewHaven,Connecticut,USA;bYale Stem Cell Center,Yale University School of Medicine,New Haven,Connecticut,USA;cDepartment of Genetics and Developmental Biology,University of Connecticut Stem CellInstitute,University of Connecticut Health Center,Farmington,Connecticut,USA;dDepartment of Chemistry,Wenzhou University,Zhejiang,Peoples Republic of ChinaKey Words.Lin28Stem cellTranslationGrowthMetabolismABSTRACTLin28 inhibits the expression of let-7 microRNAs but alsoexhibits let-7-independent functions.Using immunoprecipi-tation and deep sequencing,we show here that Lin28 pref-erentiallyassociateswithasmallsubsetofcellularmRNAs.Of particular interest are those for ribosomalproteins and metabolic enzymes,the expression levels ofwhich are known to be coupled to cell growth and sur-vival.Polysome profiling and reporter analyses suggestthat Lin28 stimulates the translation of many or most ofthese targets.Moreover,Lin28-responsive elements werefound within the coding regions of all target genes tested.Finally,a mutant Lin28 that still binds RNA but fails tointeract with RNA helicase A(RHA),acts as a dominant-negative inhibitor of Lin28-dependent stimulation of trans-lation.We suggest that Lin28,working in concert withRHA,enhances the translation of genes important for thegrowth and survival of human embryonic stem cells.STEMCELLS2011;29:496504Disclosure of potential conflicts of interest is found at the end of this article.INTRODUCTIONHighly expressed in human embryonic stem cells(hESCs),Lin28 facilitates the reprogramming of fibroblasts to inducedpluripotent stem cells(iPSCs)by increasing the number ofreprogrammed clones 1.This is consistent with a role forLin28 in cell growth and survival.Also consistent is the recentreport that Lin28 knockout mice were severely underdevelopedand nonviable 2.These effects likely result from several dis-tinct molecular functions.Lin28 inhibits the biogenesis of agroup of microRNAs,among which are the let-7 family micro-RNAs shown to participate in the regulation of expression ofgenes involved in cell growth and differentiation 3,4.Thisprotein binds to the loop regions of microRNA precursors andblocks their processing into mature microRNAs 57.In addi-tion,Lin28 induces uridylation of the precursors and promotestheir degradation 810.On the other hand,Lin28 alters cellfates during neurogliogenesis via mechanisms distinct fromthose mediated by let-7 and causes changes in gene expressionbefore any effect on let-7 could be detected 11.Likewise,amutant Lin28 that permits let-7 production could still com-pletely inhibit gliogenesis 11.Moreover,Zhu et al.2 haverecently demonstrated that transgenic mice that overexpressLin28 exhibit overgrowth and delayed onset of puberty.How-ever,no decrease in the level of let-7 was observed in thehypothalamic-pituitary-gonadal axis that plays a critical role incontrolling development and reproduction.Therefore,mecha-nisms other than let-7-mediated pathways must also play im-portant roles in Lin28-dependent gene regulation.During mus-cle cell differentiation,Lin28 binds to insulin-like growthfactor(IGF)-2 mRNA and stimulates its translation 12.It alsoselectively binds to mRNAs of the key pluripotency factorOct4 and a subset of cell cycle-related factors and promotestheir expression at the post-transcriptional level 1315.Lin28-responsive elements(LREs)have been mapped to the50-,30-untranslated regions,or open reading frames(ORFs)ofmRNAtargets1215.Recently,post-transcriptionalAuthor contributions:S.P.:collection and assembly of data,data analysis and interpretation;L.-L.C.:data analysis and interpretation,financial support;X.-X.L.:collection and assembly of data;L.Y.:data analysis and interpretation;H.L.:conception and design,financialsupport;G.G.C.:conception and design,financial support;Y.H.:conception and design,data analysis and interpretation,financialsupport.*Present address:Cancer Research Institute,Central South University,Hunan,Peoples Republica of China.Correspondence:Yingqun Huang,M.D.,Ph.D.,Department of Obstetrics,Gynecology and Reproductive Sciences,Yale UniversitySchool of Medicine,New Haven,Connecticut,USA.Telephone:[phone];Fax:[phone];e-mail:yingqun.huangyale.eduReceived November 1,2010;accepted for publication December 16,2010;first published online in STEMCELLSEXPRESSJanuary7,2011.VCAlphaMed Press 1066-5099/2009/$30.00/0 doi:10.1002/stem.591STEMCELLS2011;29:496504 www.StemCregulation mediated by Lin28 has been shown to require afunctional interaction with RNA helicase A(RHA)15.MATERIALS ANDMETHODSAntibodies,siRNAs,and PlasmidsTheantibodiesspecific for highmobility group AT-hook1(HMGA1)(SantaCruz,sc-8982;SantaCruz,CA,http:/ Cruz,sc-15363),ribo-somal protein S13(RPS13)(Protein Tech Group Inc.,16680-1-AP;Chicago,IL,http:/ translationelongation factor 1 gamma(EEF1G;Abcam,ab72368;Cam-bridge,MA,http:/ Cruz,sc-5279),RHA(Abcam,ab54593),b-tubulin(Abcam,ab6046),b-actin(Abcam,ab8226),Flag(Santa Cruz,sc-807;Stratagene,200472;Santa Clara,CA,www.stratagene.-com),and rabbit pre-immune serum(SouthernBiotech,0040-01;Birmingham,AL,)were purchased.The siLin28(Dharmacon,ON-TARGETplus SMARTpool,L-018411-01;Lafayette,Colorado,),siLin28-2(an equal molar mixture of two siRNAs,J-018411-09 and J-018411-11),siCon(Dharmacon,D-001810-10-05),and the plas-mid-expressing Flag-Lin28 were previously described 15.Flag-Lin28DC was created by cloning a PCR fragment containing partof the human Lin28 coding region(aa 1176,relative to thetranslational start site)into pFLAG-CMV-2(Sigma,E7398)atthe NotI and BamHI sites.The luciferase reporter constructsOct4-R2,Oct4-R4 15,and H2a 14 were previously docu-mented.Constructs Oct4-95(Gene ID:NM_002701),HMGA1-ORF(GeneID:NM_002131),RPS13-ORF(GeneID:NM_001017),EEF1G-R3(Gene ID:NM_001404),and Oct4-70(Gene ID:NM_002701)were made by inserting PCR fragmentscontaining nucleotides 516610,323613,33488,8111,140,and 541610(relative to the transcriptional start sites)of the cor-responding genes,respectively,at the NotI and XhoI sites of thefirefly reporter vector 14.Cell Culture and TransfectionThe culture and transfection of the hESC line H1(WA01,WiCell),embryonal carcinoma(EC)line PA-1,and HEK293cells were carried out as preciously described 15.Protein Extraction and Western Blot AnalysisThese were carried out as described in 15.Ribonucleoprotein Particle Immunoprecipitation andRT-qPCRRibonucleoproteinparticle(RNP)immunoprecipitation(IP)experiments were carried out essentially as described 15.Toprepare samples for deep sequencing,IP was scaled up 10-fold.The real-time PCR primers are listed below.b-actin forward:50-ATCAAGATCATTGCTCCTCCTGAG;b-actin reverse:50-CTGCTTGCTGATCCACATCTG;b-tubulin forward:50-CGTGTTCGGCCAGAGTGGTGC;b-tubulin reverse:50-GGGTGAGGGCATGACGCTGAA;Lin28 forward:50-CGGGCATCTGTAAGTGGTTC;Lin28 reverse:50-CAGACCCTTGGCTGACTTCT;Oct4 for-ward:50-GTGGAGGAAGCTGACAACAA;Oct4 reverse:50-GCCGGTTACAGAACCACACT;firefly luciferase forward:50-GCTGGGCGTTAATCAGAGAG;firefly luciferase reverse:50-GTGTTCGTCTTCGTCCCAGT;Renilla forward:50-GCAAATCAGGCAAATCTGGT;Renilla reverse:50-GGCCGACAAAAATGATCTTC;HMGA1 forward:50-CAGCGAAGTGCCAACACCTAAG;HMGA1 reverse:50-CCTTGGTTTCCTTCCTGGAGTT;RPS13forward:50-CTCTCCTTTCGTTGCCTGAT;RPS13reverse:50CCCTTCTTGGCCAGTTTGTA;eukaryotic translation initia-tion factor 4A(EIF4A)forward:50-TGCTTAACCGGAGATACCTGTC;EIF4A reverse:50-GTCCCTCATGAACTTCTTGGTC;CD63forward:50-CCCGAAAAACAACCACACTGC;CD63reverse:50-GATGAGGAGGCTGAGGAGACC;EEF1G forward:50-AGCGGAAGGAGGAGAAAAAG;EEF1G reverse:50-GACCAGCCGTCCTTATCAAA.Deep Sequencing AnalysisLin28 and preimmune IP RNA samples from H1 cells were usedfor deep sequencing analysis,and the sequencing libraries wereprepared according to the manufacturers instructions(Illumina,P/N 1004814;San Diego,CA,http:/ extracted from IP samples were treatedby two successive rounds of oligo-dT selection.The poly(A)RNAs were fragmented using divalent cations under elevatedtemperature,followed by first and second strand cDNA synthesiswith random hexamer priming.The cDNA fragments werecleaned up,end-repaired,and phosphorylated at their 50ends.Af-ter a nontemplated 30end addition of A residues,Illumina adapt-ers were ligated to both ends,and?300-bp fragments were iso-lated and amplified by PCR using Illumina adapters.The librariesderived from Lin28 IP and preimmune IP samples were individu-ally used for sequencing on an Illumina GAII platform using asingle-readprotocol.Approximately10millionreadswereobtained from each IP sample,and these sequences were alignedto the human genome using Bowtie 16.For both preimmuneand Lin28 IP libraries,?4.7 to?6.0 million reads were uniquelyaligned.The sequencing reads were uniquely aligned to thehuman hg18 genome and splice junction index using Bowtie 16that allows up to two mismatches.Wiggle track files were gener-ated from Bowtie output files by a custom bowtie2wiggle scriptand loaded onto the UCSC genome browser(2006;http:/www.genome.ucsc.edu)for visualization.Gene expression levelswere determined by calculating quantitative RPKM scores(ReadsPer Kilobase of gene model per Million mapped reads)asdescribed17.Therawdatacanbeaccessedathttp:/www.ncbi.nlm.nih.gov/geo/query/acc.cgi?tokennrktvaqeewuiyr-s&accGSE23109.mRNAs that were enriched by at least 2.5-fold in the Lin28 IP compared with preimmune were selected assignificant Lin28 targets.Gene Ontology Analysis.Gene ontology(GO)terms of Lin28IP mRNA targets were identified using the Funcassociate 2.0 soft-ware 18,where these mRNAs were used as the query set andall human genes as the gene space set.Sucrose Gradient Polysome FractionationThese were carried out essentially as described previously 15.Briefly,PA-1 cells(3?107)were harvested,washed with PBS,and resuspended in 0.5 ml of freshly prepared extraction buffer(100 mM KCl,0.1%TritonX-100,50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid(HEPES),pH 7.4,2 mM MgCl2,10%glycerol,1 mM dithiothreitol(DTT),20 U/ml ProtectorRNase Roche,1?complete mini EDTA-free protease inhibitorcocktail Roche).After incubation on ice for 10 minutes,thelysate was centrifuged at 1,300g at 4?C for 10 minutes to removeinsoluble materials.The supernatant was applied onto the top ofa 15%55%(wt./wt.)linear sucrose gradient and centrifuged at150,000 g for 3 hours in a Beckman ultracentrifuge.Fractions(0.2 ml each)were collected and used for RNA extraction or pro-tein analysis.In the case of polysome IP,pooled polysome frac-tions in a total of?4 ml were divided into two tubes and incu-bated with protein A sepharose beads prebound with either anti-Lin28 antibody or preimmune IgG at 4?C overnight.BoundRNAs were extracted and used in reverse transcription and quan-titative polymerase chain reaction(RT-qPCR)analysis.Luciferase AssaysThese were carried out basically as previously described 13.Briefly,the indicated firefly luciferase reporter plasmids wereeach transfected into HEK293 cells,with or without cotransfec-tion of Flag-Lin28 or Flag-Lin28DC.The Renilla reporter wasPeng,Chen,Lei et al.497www.StemCincluded in all transfections for normalization purposes.Transfec-tion was carried out in a 48-well plate scale.The amount of totalplasmid DNA per well was 400 ng that included 100 ng of fireflyluciferase reporter,2 ng of Renilla,and the indicated amounts ofFlag-Lin28 or Flag-Lin28DC.CoimmunoprecipitationTo examine the interaction between Flag-Lin28(or Flag-Lin28DC)with RHA,8?106HEK293 cells were transfected with 6 lg ofFlag-Lin28,Flag-Lin28DC,or empty vector in a 6-cm plate scale.Cells were collected 48 hours later by manual scraping using arubber policeman and pelleted by centrifugation.Cell pellet waswashed once with PBS and resuspended in 400 ll of gentle lysisbuffer(10 mM Tris-HCl at pH 7.5,10 mM NaCl,10 mM EDTA,0.5%TritonX-100,1 mM phenylmethylsulfonyl fluoride(PMSF),1?protease inhibitor cocktail Calbiochem,1 mM DTT,and 10lg/ml of RNase A Roche)and incubated on ice for 15 minutes.Insoluble materials were removed by centrifugation at 13,400 g ina microcentrifuge at 4?C for 15 minutes.NaCl was added to thecleared lysate to a final concentration of 250 mM,and 350 ll ofthe lysate incubated with 10 ll of protein A sepharose beads pre-bound with 10 lg of monoclonal anti-Flag M2 antibody at 4?Covernight.The next day,beads were washed and bound fractionseluted with 3?SDS-sample buffer by heating at 95?C for 5minutes.Proteins were resolved by SDS-polyacrylamide gel elec-trophoresis(PAGE),followed by Western blot analysis.RESULTSLin28 Knockdown Affects hESC GrowthBoth human and mouse ESCs proliferate rapidly and have aunique cell cycle thought to be biologically coupled to pluripo-tency 19,20.This,coupled with the additional evidence dis-cussed above suggesting that Lin28 is involved in stem cellproliferation,led us to ask whether Lin28 might play a directrole in the growth and survival of hESCs.Therefore,we inhib-ited Lin28 expression using a Lin28-specific siRNA(siLin28)15,21.siLin28 reduced Lin28 expression to 8%and 12%ofthe control at the RNA(Fig.1A)and protein(Fig.1B)level,respectively.Importantly,we observed a concomitant decreasein the number of viable cells(Fig.1C,left panel)and anincrease in apoptosis,which was indicated by an elevated levelof caspase 3/7 activity(Fig.1C,right panel).To rule out pos-sible nonspecific(i.e.,off-target)effects of siLin28,we alsoused another siRNA(siLin28-2;15)targeted to a differentregion of Lin28 mRNA and obtained similar results(Support-ing Information Fig.S1).Taken together with our previousfindings in mouse ESCs that reducing Lin28 expression slowscell growth and overexpressing Lin28 accelarates cell growth13,our results support the conclusion that Lin28 is importantfor the growth and survival of hESCs.We cannot conclude,however,that Lin28 is absolutely essential for hESC viabilityin vivo.Under our cell culture conditions,we see significantcell death;however,Lin28 knockout mice,though nonviableand weighing less than 20%of wild-type mice at birth 2,suggest that Lin28 deficiency severely compromises cellgrowth but is not obligatory under all conditions.Genome-Wide Identification of Lin28 mRNATargetsHow might Lin28 exert its biological effects?Most likely,bothlet-7-dependentandlet-7-independentpathwaysareinvolved.To investigate the contribution of mRNA targetsthat might be regulated by Lin28,we developed a genome-wide approach.Thus,we isolated Lin28-containing RNPsfrom hESCs by IP,followed by identification of associatedmRNAs using cDNA synthesis and high throughput deepsequencing with the Illumina platform.The detailed proce-dures are outlined in Materials and Methods and the fulllist of mRNAs enriched by Lin28 IP